Getting started

Installation

stitchr runs on Python3, and can be installed via pip:

pip install stitchr

In order to automatically download the necessary data for stitching, IMGTgeneDL is also required. If it’s not automatically installed alongside stitchr, it can be installed with:

pip install IMGTgeneDL

After installing stitchr via pip, IMGTgeneDL can be used via the stitchrdl command to download suitably formatted data sets to the required directory like so:

stitchrdl -s human

See the Species covered section for details on the species for which data can be downloaded in this manner.

There are also some optional functions that require additional dependencies:

• The -aa alignment function of stitchr requires Biopython

  • pip install Bio

• The graphical user interface version GUI-stitchr requires PySimpleGUI

  • pip install PySimpleGUI

  • This also might require the installation of Tkinter

Quick start example

The only required fields are the minimal components describing a single rearranged TCR chain: V gene name, J gene name, and CDR3 sequence (either DNA or amino acids). Constant regions must also be specified for all non-human/non-mouse species.

stitchr -v [IMGT V gene] -j [IMGT J gene] -cdr3 [CDR3aa]

stitchr -v TRBV7-3*01 -j TRBJ1-1*01 -cdr3 CASSYLQAQYTEAFF

stitchr -v TRAV1-2 -j TRAJ33 -cdr3 TGTGCTGTGCTGGATAGCAACTATCAGTTAATCTGG

See the Using stitchr section for more detailed usage instructions. stitchr can also be run in a high-throughput manner (see Thimble), or via a simple graphical user interface (see GUI-stitchr).